Monday, February 26, 2001

leaf I redid my archive page. The old one was kind of hard to find, and the format really didn't fit the nature of the page. The photograph that I used to make the new design was the 1,000th one that I have taken with my camera. That's about 41.6667 rolls of 24 exposure film in less than two months, or about 16.667 photos a day.

posted by Alison 2/26/2001 08:07:00 PM : (0) comments : splink


Sunday, February 25, 2001

leaf I'm too sexy for Milan, New York, and JapanAaron and I have decided to start a new trend: wearing Styrofoam cups as facial accessories. Don't hate me because I'm beautiful What's not to love; you even get that bonus red ring around you mouth when you're done. Doesn't our overwhelming charisma win you over even when we're doing something that most people give up after the 4th grade. Next week: orange wedges as mouth guards. One word: sexy.

posted by Alison 2/25/2001 11:56:00 PM : (0) comments : splink

leaf Wouldn't Aaron have been a great Gap model? Doesn't he have that perfect "I love my clothes" look? You should hire him. Now. Put him on the cover of your magazine or in that bus ad or on one of those free promotional post cards. I promise that he will not disappoint. But he's not cheap, so have your checkbook ready; almost any price would be too small for this advertisement gem.

posted by Alison 2/25/2001 11:37:00 PM : (0) comments : splink

leaf Oh yeah, I might have forgotten to mention: I went to an anime convention last week. I went with the university anime club, Hello Kitty is getting marriedand I actually had a good time. My favorite thing was seeing the goth couples. "We know you're both tormented spirits dying on the inside, but you look so cute when you wear matching eyeliner and hold hands." I didn't spend all that much money, but I did pick up 3 volumes of manga in the original japanese (1 Cowboy Bebop, 2 Hana Yori Dango). I also enjoyed the wedding hello kitty in the $5 bargain bin. Neither Aaron nor I had the guts to buy it, but I had to take a picture.

posted by Alison 2/25/2001 11:21:00 PM : (0) comments : splink

leaf kawaii!!Laura is very cute; she's cute even when she isn't dressed up like Petit Carat. Hersite is also cute, and it's backed up by some good design. I like the non-frames version even better than the frames version. It's an excellent fan site if you're in to anime, and it's still fun even if you're not.


posted by Alison 2/25/2001 11:06:00 PM : (0) comments : splink

leaf Okay, here are the credits for this new layout:

The little octopus icons are from an animal font by fontalicious. So if you like it there are lots more.

One of the pairs of chopsticks belongs to my hall mate, Michelle, who was kind enough to let me photograph them. So, thanks Michelle. They're the wooden ones on the right with the stripes.

All of the photographs were taken by me, so please give me credit if you want to steal them.

posted by Alison 2/25/2001 12:12:00 AM : (0) comments : splink


Saturday, February 24, 2001

leaf The bear on the new splash page is from Digi Carat, an anime series consisting of 3 minute shorts. The bear really doesn't have a name, but it's supposed to look angry, sad, embarrased, and happy all at the same time. I scanned the picture from Clark's poster and manipulated it myself, so if you want to use it for yourself please let me know.

posted by Alison 2/24/2001 11:57:00 PM : (0) comments : splink

leaf How do you like the new version? There are still a few bugs to squash, but this is pretty much what will be here for the next few months. You might have noticed that I got rid of the main page (probably not, but let me have my ego). It seemed a bit superfluous, and it was difficult to update. But if you miss it, it is still here.

posted by Alison 2/24/2001 11:10:00 PM : (0) comments : splink


Thursday, February 22, 2001

leaf So, Michael Samyn went up about 20 cool points in my book. Apparently, he had read my mini-review of eden.garden, and felt that he needed to write me an email about it. It turned out to be a really nice email, not a standard form letter at all. I have to give credit to anyone who will take the time to read the trash I write on my page, and then take even more time to write to me about it.

Thanks to Michael for actually caring about what us little people think. And check out eden.garden 2.0 when it comes out (go to entropy8zuper.org/ and sign up for the email list).

posted by Alison 2/22/2001 11:19:00 AM : (0) comments : splink


Wednesday, February 21, 2001

leaf
Pinwheel Hair Combs
Rubber duck Fern
I came home very tired today, but instead of taking a nap I decided to take pictures. I also turned a lot of my flower pictures into wallpaper. You can find them at webshots here. Maybe I'll post more pictures later.

posted by Alison 2/21/2001 11:39:00 PM : (0) comments : splink


Sunday, February 18, 2001

leaf The GW anime club web site is finally up. Go check it out.

posted by Alison 2/18/2001 09:18:00 PM : (0) comments : splink


Friday, February 16, 2001

leaf Bitterness turns one year olderYesterday was bitterness's birthday so we threw a party. A few of my friends came over, as many as can fit in my tiny room. mmmm...bitterness!We had two little tiramisu cakes ordered from the watergate complex, on had a marzipan disk that read 'happy birthday bitterness.' I think the folks at the bakery had a good laugh at that one. Actually, like many things this sort of started as a joke. It seemed appropriate to have a bitterness party around Valentines day when most of my friends were, well, bitter. The cakes were excellent, and the company was even better.

posted by Alison 2/16/2001 10:01:00 AM : (0) comments : splink


Thursday, February 15, 2001

leaf Brian danced for me yesterday and lip synched Janet Jackson's 'If.' The video of that will be posted on my idrive soon. Trust me, it's worth a look.

posted by Alison 2/15/2001 03:07:00 PM : (0) comments : splink

leaf Bonus: Heart shaped drinking strawsI actually had a pretty good Valentine's day yesterday. Clark bought me flowers and took me out to a Japanese restaurant in Virginia called Matsuba. The cab ride over was kind of entertaining because the cab driver was quite lewd in an amusing sort of way. yummy food ""Really, you can borrow my cab if you need it." "Umm, no thanks." Matsuba was really crowded, but luckily we had made dinner reservations. The food was good, especially the eel. After that we hitched a ride to the Pentagon and spent a couple of minutes looking for the subway entrance. I have never really been close enough to see how massive the Pentagon is, but it's quite impressive.

posted by Alison 2/15/2001 03:02:00 PM : (0) comments : splink


Wednesday, February 14, 2001

leaf Blogger was dead for a while and it was quite sad. I'm sure I would have just posted junk, anyway.

posted by Alison 2/14/2001 02:13:00 PM : (0) comments : splink


Monday, February 12, 2001

leaf Actually, after reading this review I kind of want to check out this book. Bonus! "These more philosophical ruminations can make Wenderoth sound like an overeducated Jack Handey..."

posted by Alison 2/12/2001 09:38:00 PM : (0) comments : splink

leaf Sometimes I forget about feedmag and then when I find it again, I wonder why I stopped reading it. It's probably because I have better things to do. But here is a disturbing yet interesting article about dolls houses as crime tools.

posted by Alison 2/12/2001 09:33:00 PM : (0) comments : splink


Sunday, February 11, 2001

leaf shirt: invoke, prevoke, evokeI'm hoarse from playing Encore yesterday. We spent about half an hour screaming television theme songs at one another until we just gave up; we all just watched too much TV as kids. It was a fun game, but I think we drove the neighbors crazy when we insisted on singing the theme to the Fresh Prince of Bel Air in its entirety. The highlight of the evening actually came earlier when Brian put on a shirt that was too small for him and pranced around for all of us.

posted by Alison 2/11/2001 01:29:00 PM : (0) comments : splink

leaf On the 13th my friends and are planning an anti-Valentine's Day. We'll be ordering a cake from the Watergate bakery. It will be tiramisu style and say 'happy birthday bitterness' on it. I hold the firm belief that whether you have someone or not, Valentine's is just a bad holiday.

posted by Alison 2/11/2001 12:46:00 PM : (0) comments : splink


Thursday, February 08, 2001

leaf Hmmm...

CTCTTGTCAGCGTCTTTCAGAAGACCTGGTGGGGNAAGTCCGTGGG CATCATGTTGACCGAGCTGGAGAAAGCCTTGAACTCTATCATCGAC GTCTACCACAAGTACTCCCTGATAAAGGGGAATTTCCATGCCGTCT ACAGGGATGACCTGAAGAAATTGCTAGAGACCGAGTGTCCT

This code from the human genome reads:
^$x25gg#nzuo%z$$kq=lvuc@u^3$=%)-+s^#mfzu1-8%)

See anything significant?

posted by Alison 2/08/2001 10:15:00 AM : (0) comments : splink

leaf Once again I found another cool encoding program.

TTGGCAACGAAGGTAATGAAGGTAATGACCGGTGTCGCAACGA CAGGCATGAAGGGTGCAACAGGCACAGTAGCAAAGGGTAGAA TGACAGGTAGCGTCATAACAGGCTAG

Here is the decoder.
I wonder if my miles and miles of DNA spell anything special.

posted by Alison 2/08/2001 09:34:00 AM : (0) comments : splink


Wednesday, February 07, 2001

leaf Today looks like another very long day. I know that I'm going to be busy until 10:00. It kind of makes me feel tired when my day hasn't even started yet.

posted by Alison 2/07/2001 10:28:00 AM : (0) comments : splink


Monday, February 05, 2001

leaf I said:
01010011011011110110110101100101011101000110100101101101
01100101011100110010110000100000010010010010000001110100
01101000011010010110111001101011001000000111000001100101
01101111011100000110110001100101001000000110100001100001
01110110011001010010000001110100011011110110111100100000
01101101011101010110001101101000001000000111010001101001
01101101011001010010000001101111011011100010000001110100
01101000011001010110100101110010001000000110100001100001
01101110011001000111001100101110001000000100001001110101
01110100001000000111010001101000011010010111001100100000
01101001011100110010000001110100011010000110010100100000
01100011011011110110111101101100011001010111001101110100
00100000011101000110100001101001011011100110011100100000
01001001001001110111011001100101001000000111001101100101
01100101011011100010000001100001011011000110110000100000
01100100011000010111100100101110

Go here to decode. Link via Shunt.org.

posted by Alison 2/05/2001 10:23:00 PM : (0) comments : splink


Sunday, February 04, 2001

leaf And for all those mac users there is now an Iron Chef icon set courtesy of the Icon Factory. Both of the above links are from the Iron Chef Compendium.

posted by Alison 2/04/2001 11:21:00 AM : (0) comments : splink

leaf For all those Iron Chef fans there's now a great parody at IFILM called Lego Chef. It's quite well done, they even nailed the voice of that annoying actress who always giggles. Since the theme ingredient was changed for the humor elements, and the original Japanese voice-overs were kept, you can tell what battle the dialogue came from. I dunno, it sounds like he said 'kamo,' which is wild duck. Any better interpretations? Is there even a duck battle?

posted by Alison 2/04/2001 11:13:00 AM : (0) comments : splink


Thursday, February 01, 2001

leaf I feel like a sack of potatos, like something lumpy, heavy, and wrapped in burlap.

posted by Alison 2/01/2001 08:46:00 PM : (0) comments : splink

Archive


Powered by Blogger


prime-number.com/Blog

Friendly Message:
This website was made with no preservatives or animal products. Not tested on animals.

3 Second Bio:
The author is currently a registered alien living in Nagoya, Japan. The author is teaching and studying computer science in Washington, DC. Alison is working on her Ph.D. at the Language Technologies Institiute at Carnegie Mellon University. She is working on a Machine Translation System for minority languages (those spoken by fewer than 2 Million People).



Elsewhere:
Bio
Graphics Homework
Wallpaper
GW Anime
Nice People
GWU
Archive
Email Me

Flash Failures:
Old Flash Page
Aquarium
KiteBuilder
Shapes

I belong to:
Photographica
Virtual Tourist

People I: Know/Sort of Know/Don't Know:
» Carolina
» Instapundit
» Laura
» Carolina
» Aaron
» Mister Pants

Old Versions:
Early to Rise
Chopstick
Equine
Bubble
Fly Trap

Old Splash Pages:
»Original Recipe
»Sketch of Clark
»Big Blob
»Another Big Blob
»Digi Charat Bear
»Linoleum Samples




Google



Search WWW
Search www.prime-number.com



Current Weather in Pittsburgh, PA: The WeatherPixie